Genome Bioinformatics: FAQ. The multiple alignment format stores a series of multiple alignments in a format that is easy to parse and relatively easy to read. This format stores multiple alignments at the DNA level between entire genomes. Previously used formats are suitable for multiple alignments of single proteins or regions of DNA without rearrangements, but would require considerable extension to cope with genomic issues such as forward and reverse strand directions, multiple pieces to the alignment, and so forth. General Structure The .maf format is line-oriented. Each multiple alignment ends with a blank line.
The file is divided into paragraphs that terminate in a blank line. An "i" line containing information about what is in the aligned species DNA before and after the immediately preceding "s" line an "e" line containing information about the size of the gap between the alignments that span the current block a "q" line indicating the quality of each aligned base for the species Custom Tracks Header Line. Explain SAM Flags. Software. As a leading genomics centre, the Sanger Institute often needs to develop software solutions to novel biological problems. All our software is made available to the research community and is open access, recognising that community improvement is essential to maximising efficiencies in software development. Top downloads Artemis - a free genome viewer and annotation tool that allows visualisation of sequence features and the results of analyses within the context of the sequence, and also its six-frame translation ACT - a DNA sequence comparison viewer written in Java.
It is based on the software for Artemis, the genome viewer and annotation tool SSAHA2 - a pairwise sequence alignment program designed for the efficient mapping of sequencing reads onto genomic reference sequences. The Simple Fool's Guide - The Guide. VarScan - Variant Detection in Massively Parallel Sequencing Data. Overview of Structural Variation. Bowtie 2: Manual. Version 2.2.1 What is Bowtie 2? Bowtie 2 is an ultrafast and memory-efficient tool for aligning sequencing reads to long reference sequences. It is particularly good at aligning reads of about 50 up to 100s or 1,000s of characters to relatively long (e.g. mammalian) genomes.
Bowtie 2 indexes the genome with an FM Index (based on the Burrows-Wheeler Transform or BWT) to keep its memory footprint small: for the human genome, its memory footprint is typically around 3.2 gigabytes of RAM. Bowtie 2 is often the first step in pipelines for comparative genomics, including for variation calling, ChIP-seq, RNA-seq, BS-seq.
If you use Bowtie 2 for your published research, please cite the Bowtie paper. How is Bowtie 2 different from Bowtie 1? Bowtie 1 was released in 2009 and was geared toward aligning the relatively short sequencing reads (up to 25-50 nucleotides) prevalent at the time. The chief differences between Bowtie 1 and Bowtie 2 are: Bowtie 2 is not a "drop-in" replacement for Bowtie 1. Download Tablet. The most recent release of Tablet is 1.13.12.17 (17th December 2013). View the release notes to see what’s new. Please use the links below to download the Tablet installer most suitable for your operating system. Tablet is currently available for: Windows (32 bit) or Windows (64 bit) Linux (32 bit) or Linux (64 bit) OS X (note requirements below) A Java Web Start version of Tablet also exists.
Follow the instructions provided by the graphical installer to install Tablet. Tablet is primarily developed on Windows 7, and gets additional regular testing on OS X and Centos. Archived versions You can download a limited selection of older copies of Tablet from our archive. Additional downloads coveragestats.py – python script that summarizes the coverage export file from Tablet. OS X requirements Tablet relies on Java 7 which is only officially supported on OS X 10.7.3 or later, however you may still be able to run it on earlier versions. Source code. Ben Langmead. Searching for SNPs with cloud computing. Alignment and SNP calling in Hadoop Hadoop is an implementation of the MapReduce parallel programming model. Under Hadoop, programs are expressed as a series of map and reduce phases operating on tuples of data.
Though not all programs are easily expressed this way, Hadoop programs stand to benefit from services provided by Hadoop. For instance, Hadoop programs need not deal with particulars of how work and data are distributed across the cluster; these details are handled by Hadoop, which automatically partitions, sorts and routes data among computers and processes. Hadoop also provides fault tolerance by partitioning files into chunks and storing them redundantly on the HDFS.
When a subtask fails due to hardware or software errors, Hadoop restarts the task automatically, using a cached copy of its input data. A mapper is a short program that runs during the map phase. Crossbow's efficiency requires that the three MapReduce phases, map, sort/shuffle and reduce, each be efficient. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Bowtie indexes the reference genome using a scheme based on the Burrows-Wheeler transform (BWT) [17] and the FM index [18,19]. A Bowtie index for the human genome fits in 2.2 GB on disk and has a memory footprint of as little as 1.3 GB at alignment time, allowing it to be queried on a workstation with under 2 GB of RAM. The common method for searching in an FM index is the exact-matching algorithm of Ferragina and Manzini [18]. Bowtie does not simply adopt this algorithm because exact matching does not allow for sequencing errors or genetic variations. We introduce two novel extensions that make the technique applicable to short read alignment: a quality-aware backtracking algorithm that allows mismatches and favors high-quality alignments; and 'double indexing', a strategy to avoid excessive backtracking.
Burrows-Wheeler indexing The BWT is a reversible permutation of the characters in a text. The Burrows-Wheeler transformation of a text T, BWT(T), is constructed as follows. Figure 1. Elementolab/BWA tutorial - Icbwiki. From Icbwiki Introduction BWA (Burrows-Wheeler Aligner)is a program that aligns short deep-sequencing reads to long reference sequences. Here is a short tutorial on the installation and steps needed to perform alignments. You can align the short reads to the genome or the transcriptome depending on the experiment/application.
Installation Download and install BWA on a Linux/Mac machine NOTE: You need to do this only once!! Download: Then: bunzip2 bwa-0.5.9.tar.bz2 tar xvf bwa-0.5.9.tar cd bwa-0.5.9 make Add bwa to your PATH by editing ~/.bashrc and adding export PATH=$PATH:/path/to/bwa-0.5.9 # /path/to is an example ! Then execute the command in using source. source ~/.bashrc (in some systems, ~/.bash_profile is used in place of ~/.bashrc) Then, to test if the installation was successful, just type: bwa If Unix can find bwa, the 'bwa' command alone will show you all of the options available. Download the reference genome Then erase chromosome files: 1. 2. The Sequence Alignment/Map format and SAMtools. + Author Affiliations *To whom correspondence should be addressed. Received April 28, 2009. Revision received May 28, 2009. Accepted May 30, 2009. Abstract Summary: The Sequence Alignment/Map (SAM) format is a generic alignment format for storing read alignments against reference sequences, supporting short and long reads (up to 128 Mbp) produced by different sequencing platforms.
Availability: Contact: rd@sanger.ac.uk With the advent of novel sequencing technologies such as Illumina/Solexa, AB/SOLiD and Roche/454 (Mardis, 2008), a variety of new alignment tools (Langmead et al., 2009; Li et al., 2008) have been designed to realize efficient read mapping against large reference sequences, including the human genome. The Sequence Alignment/Map (SAM) format is designed to achieve this goal. In this article, we present an overview of the SAM format and briefly introduce the companion SAMtools software package. 2.1 The SAM format Fig. 1. 2.1.2 Extended CIGAR. FASTX-Toolkit. Introduction The FASTX-Toolkit is a collection of command line tools for Short-Reads FASTA/FASTQ files preprocessing. Next-Generation sequencing machines usually produce FASTA or FASTQ files, containing multiple short-reads sequences (possibly with quality information). The main processing of such FASTA/FASTQ files is mapping (aka aligning) the sequences to reference genomes or other databases using specialized programs.
Example of such mapping programs are: Blat, SHRiMP, LastZ, MAQ and many many others. However, It is sometimes more productive to preprocess the FASTA/FASTQ files before mapping the sequences to the genome - manipulating the sequences to produce better mapping results. The FASTX-Toolkit tools perform some of these preprocessing tasks. Available Tools FASTQ-to-FASTA converterConvert FASTQ files to FASTA files. Tools demonstration Visit the Hannon lab public galaxy server to see a demonstration of these (and other) tools.
News 02-Feb-2010 - Version 0.0.13 Dec-2009 - Version 0.0.12. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Velvet: Algorithms for de novo short read assembly using de Bruijn graphs. Sense from sequence reads: methods for alignment... [Nat Methods. 2009. A survey of sequence alignment algorithms for next-generation sequencing. A survey of sequence alignment algorithms fo... [Brief Bioinform. 2010. Fast and accurate short read alignment with Burrows–Wheeler transform. Mapping short DNA sequencing reads and calling variants using mapping quality scores. EMBOSS: the European Molecular Biology Open Sof... [Trends Genet. 2000. BioJava: an open-source framework for bioinformatics. The Bioperl Toolkit: Perl Modules for the Life Sciences.
A library of efficient bioinformatics al... [Appl Bioinformatics. 2003. Biopython: freely available Python tools for computational molecular biology and bioinformatics. Making whole genome multiple alignments usable for biologists. + Author Affiliations * To whom correspondence should be addressed. Received March 22, 2011. Revision received May 18, 2011. Accepted June 27, 2011. Abstract Summary: Here we describe a set of tools implemented within the Galaxy platform designed to make analysis of multiple genome alignments truly accessible for biologists. Availability and Implementation: This open-source toolset was implemented in Python and has been integrated into the online data analysis platform Galaxy (public web access: download: Contact: james.taylor@emory.edu; anton@bx.psu.edu Supplementary information: Supplementary data are available at Bioinformatics online.
With the emergence and rapid proliferation of new sequencing technologies, data generation is no longer a major challenge in genomics. MAF format in brief: the MAF format has emerged as a de facto standard for storing and exchanging whole genome multiple alignments. 2.1 Alignment extractors 2.2.1 MAF to FASTA. Manipulation of FASTQ data with Galaxy. + Author Affiliations * To whom correspondence should be addressed. Received April 1, 2010. Revision received May 20, 2010. Accepted May 24, 2010. Abstract Summary: Here, we describe a tool suite that functions on all of the commonly known FASTQ format variants and provides a pipeline for manipulating next generation sequencing data taken from a sequencing machine all the way through the quality filtering steps.
Availability and Implementation: This open-source toolset was implemented in Python and has been integrated into the online data analysis platform Galaxy (public web access: download: Contact: james.taylor@emory.edu; anton@bx.psu.edu Supplementary information: Supplementary data are available at Bioinformatics online. The proliferation of next generation sequencing technologies has created numerous data management and analysis issues. 2.1 FASTQ from FASTA and quality score files 2.2 FASTQ Groomer 2.3 Quality statistics 2.4 Read Trimmer.
Sequence file formats — Bioinformatics at COMAV 0.1 documentation. The different sequence related formats include different information about the sequence. The most common file formats in the NGS world are: fastq and sff. The SFF (Standard Flowgram Format) files are the 454 equivalent to the ABI chromatogram files. They hold information about: the flowgram,the called sequence,the qualities,and the recommended quality and adaptor clipping. These recommended clippings are given by the 454 sequencer. The Roche software takes into account the quality and the adaptor sequence to recommend a clipping for each sequence. Like the ABI files, these are binary files that should be opened with specialized programs. Fasta The fasta format is based on a simple text. >seq_1 description GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT >seq_2 ATCGTAGTCTAGTCTATGCTAGTGCGATGCTAGTGCTAGTCGTATGCATGGCTATGTGTG Usually, if we have quality information, another fasta file with the quality information could be provided.
Sanger fastq In this file every sequence has 4 lines. SAMtools. SAMtools is a set of utilities for interacting with and post-processing short DNA sequence read alignments in the SAM/BAM format, written by Heng Li. These files are generated as output by short read aligners like BWA. Both simple and advanced tools are provided, supporting complex tasks like variant calling and alignment viewing as well as sorting, indexing, data extraction and format conversion.[2] SAM files can be very large (10s of Gigabytes is common), so compression is used to save space.
SAM files are human-readable text files, while BAM files are simply the binary equivalent. BAM files are typically compressed and more efficient for software to work with. SAMtools makes it possible to work directly with a compressed BAM file, without having to uncompress the whole file. Usage and commands[edit] SAMtools commands[edit] SAMtools provides the following commands, each invoked as "samtools some_command". view The view command filters SAM or BAM formatted data. Sort index tview mpileup. FASTX-Toolkit - Command Line Usage. SAM - Genome Analysis Wiki. What is SAM The SAM Format is a text format for storing sequence data in a series of tab delimited ASCII columns. Most often it is generated as a human readable version of its sister BAM format, which stores the same data in a compressed, indexed, binary form. Currently, most SAM format data is output from aligners that read FASTQ files and assign the sequences to a position with respect to a known reference genome.
In the future, SAM will also be used to archive unaligned sequence data generated directly from sequencing machines. The current definition of the format is at [BAM/SAM Specification]. If you are writing software to read SAM or BAM data, our C++ libStatGen is a good resource to use. What Information is in SAM & BAM SAM files and BAM files contain the same information, but in a different format. Both SAM & BAM files contain an optional header section followed by the alignment section. What Information Does SAM/BAM Have for an Alignment Each Alignment has: What is a CIGAR? For example: BCF (Binary VCF) version 2 | 1000 Genomes. Please note this specification has been merged with the VCF specification and is now being maintained in github at The current specification version is 2.1. Introduction VCF is very expressive, accommodates multiple samples, and is widely used in the community. It's biggest drawback is that it is big and slow. Files are text and therefore require a lot of space on disk.
Overall, the idea behind is BCF2 is simple. This page is a more detailed description to help implementers understand the format. Overall file organization A BCF2 file is composed of a mandatory header, followed by a series of BGZF compressed blocks of binary BCF2 records. BGZF blocks are composed of a VCF header with a few additional records anda block of records. A BCF2 header follows exactly the specification as VCF, with a few extensions / restrictions: All BCF2 files must have fully specified contigs definitions.
Header Dictionary of strings Dictionary of contigs BCF2 records Integers. VCFtools Documentation. Vcftools Options. Bowtie: An ultrafast, memory-efficient short read aligner. Home | Integrative Genomics Viewer. VCF (Variant Call Format) version 4.1 | 1000 Genomes. Variant calling tutorial - Bioinformatics Team (BioITeam) at the University of Texas. Variant calling using SAMtools - Bioinformatics Team (BioITeam) at the University of Texas. GNU/Linux Command-Line Tools Summary. Linux Documentation. Samtools(1. Multisample SNP Calling. SNP calling — Bioinformatics at COMAV 0.1 documentation. 5 Things to Know About SAMtools Mpileup.