H5N1: the lab-made virus the U.S. fears could be made into a biological weapon. Photograph by Chad Baker/Ryan McVay. Here is one of the scariest things you’ll ever read: atggagagaataaaagaattaagagatctaatgtcacagtcccgcactcgcgagatactaacaaaaaccact gtggaccatatggccataatcaagaaat These are the first 100 units of a gene in an influenza virus. This particular flu virus belongs to a strain called H5N1. It breeds and spreads among birds, but on rare occasion, it can infect people. And when it does, it is frighteningly fatal, with a mortality rate of about 60 percent. Since the virus was first spotted in Hong Kong in 1997, birds have spread it to many countries. In the decade and a half since, scientists have put great effort into understanding the virus, worried that it might evolve into a pandemic that could cause a worldwide disaster.
A number of scientists agree with the board, saying that publishing too much information about this research could make it possible for terrorists to weaponize the flu. But now a pair of new studies has roused the board to action. Color-Changing Dots. Key concepts Traits Generations Natural selection From National Science Education Standards: Organisms and environments Introduction Have you ever wondered why some animals are so well camouflaged in their environments?
Have you ever seen a walking stick? It's an insect that looks just like a twig! In different environments, certain appearances are more useful than others, especially when hiding from predators. Background Over millions and millions of years, all of the different species have come to look and act the way they do through a process called evolution by natural selection.
As a result of living and having offspring in different environments, different populations develop varied appearances over time. Materials • Five to 10 different colors of construction paper • Hole puncher • Bowl • Colored fabric or different color surface (optional) • Timer (optional) Preparation • Using the hole puncher, punch out about 10 paper dots from each piece of paper. . • What dots are left? The Magic of Gravity. Bring Science Home: Activity 2 By Katherine Harmon On supporting science journalism If you're enjoying this article, consider supporting our award-winning journalism by subscribing. By purchasing a subscription you are helping to ensure the future of impactful stories about the discoveries and ideas shaping our world today. Key conceptsGravityFrictionInertia (Newton's First Law of Motion) From National Science Education Standards: Position and motion of objects IntroductionHave you ever seen a magician sweep a tablecloth quickly off a table and leave all the plates and glasses still in place?
A coin resting on a countertop isn't likely to do much—unless you or someone else does something to move it. BackgroundThe key to the famous tablecloth trick is also crucial to make this activity work: speed. Procedure• Can you get the coin into the container without using your hands? The coin isn't acting out—it's obeying the laws of physics. Share your coin drop observations and results! Bend Water with Static Electricity. Key concepts Electricity Magnetism Gravity From National Science Education Standards: Light, heat, electricity and magnetism Introduction Have you ever noticed your hair standing out on a dry day, or how a fuzzy fleece blanket can make sparks if you rub two sections of the blanket together in the dark?
Both of these things are caused by electricity—which also runs as current through wires behind light switches and electrical outlets. But the form of electricity that causes hair to stand up, known as static electricity, is much weaker (though strong enough that a buildup of static electricity can cause a slightly painful shock if you touch the right surface). Because it's weaker, static electricity doesn't work as well to power light bulbs or appliances, but you can make it do some surprising things around the house. Background Static electricity works on similar principles as a magnet. Have you ever rubbed a balloon or fuzzy fabric against your hair and watched what happens? Yeast Alive! Watch Yeast Live and Breathe. Key concepts Life Food Metabolism From National Science Education Standards: Life cycles of organisms Introduction Have you ever looked closely at a piece of sandwich bread—really closely? Notice all of those tiny holes?
They probably got there thanks to tiny living organisms called yeast. When you breathe out, part of what you are exhaling is a gas known as carbon dioxide. Background When you buy a packet of baker's yeast at the store, the organisms inside are in a state of inactivity so they don't need to eat (keeping them cool and dry helps keep them preserved this way). When you make yeast-based bread, you often have to wait for it to rise. Why do the yeast organisms "wake up" when you put them into a dough mixture? Materials • Fresh packet of baker's yeast (check the expiration date) • Tablespoon of sugar • Clear plastic bottle with a small opening (such as a water bottle) • Funnel • Small balloon • Warm water Read on for observations, results and more resources.
Find the DNA in a Banana. Key concepts Cells DNA Genes From National Science Education Standards: Reproduction and heredity Introduction What do you have in common with a banana? Even though we might not look alike, all living things—bananas and people included—are made up of the same basic material. Just like houses are made up of smaller units such as bricks, all living things are made up trillions of microscopic building blocks called cells. Within an organism, each cell contains a complete set of "blueprints". These directions determine the organism's characteristics. Background If we could zoom in on a single, tiny cell, we could see an even teenier "container" inside called a nucleus. Just like us, banana plants have genes and DNA in their cells, and just like us, their DNA determines their traits.
Materials • Ripe banana • Half cup of water • Teaspoon of salt • Resealable zip-top bag • Dishwashing soap or detergent • Rubbing alcohol • Coffee filter • Narrow glass • Narrow wooden stirrer. Recycle! Make Old Paper New. Key concepts Resources Recycling Energy From National Science Education Standards: Populations, resources and environments Introduction Do you recycle paper when you finish using it?
New paper comes from trees, which are chopped into tiny pieces and then ground up, mixed with liquid and turned into pulp. The pulp is then flattened and turned into paper. But paper is easily recycled, which helps to reduce the number of trees that have to be cut down. In the U.S., each person uses an average of 663 pounds of paper products each year. The most commonly recycled type of paper is newspaper, and today we're going to recycle our own newspaper and turn it into new paper. Background Paper is an easy material to recycle because, unlike plastic or metals, it doesn't require extreme heat to melt it down to make it into a new form, the way plastics and metals do.
And paper can't be recycled too many times. Preparation • Bend the metal coat hanger so it makes a rounded diamond shape. Nanoparticles Enlisted to Impede Alzheimer's-Inducing Brain Plaque. Researchers say that sharp-edged nanoparticles can block neurodegenerative proteins that impede cognitive function. The next challenge is making nanoparticles in this shape out of nontoxic materials By Larry Greenemeier On supporting science journalism If you're enjoying this article, consider supporting our award-winning journalism by subscribing.
By purchasing a subscription you are helping to ensure the future of impactful stories about the discoveries and ideas shaping our world today. Nanoparticles have been investigated in recent years as tools for defending the brain against neurotoxic proteins that may contribute to the onset of several different neurodegenerative disorders including Alzheimer's disease. During the onset of Alzheimer's, amyloid beta collects in the brain centers that form new memories. Although the nanotech approach has great potential, the challenges are many, including finding a nanoparticle material that is effective yet also biocompatible and nontoxic. Why Carbon Dioxide Is a Greenhouse Gas. The Australia-based Galileo Movement touts a series of "basic facts" on carbon dioxide that attempt to explain why the greenhouse gas can't contribute to climate change. John Smeed, the movement's co-founder, says the case against carbon dioxide as a global warming culprit is simply a matter of "junior school physics.
" "If you show this to any scientist and say to them, 'Disprove to me any of these points,' they can't," he said in an interview. And he's right: Many of the facts are perfectly true. But they are also irrelevant in the climate debate. And many facts about CO2 pertinent to climate science are omitted. DailyClimate.org took up Smeed's challenge and passed the fact sheet on to a climate scientist – Gavin Schmidt, a climatologist with NASA's Goddard Institute for Space Science. He also publishes the blog RealClimate.org, one of the more-respected climate science blogs.
"You've got true facts," Schmidt said of the Galileo Movement's pamphlet. Assessment: True but misleading. Federal Investigators Clear Climate Scientist, Again. The National Science Foundation has closed its investigation into Pennsylvania State University climatologist Michael Mann after finding no evidence of scientific misconduct related to his research. It is the latest in a string of investigations to exonerate scientists involved in the so-called "Climategate" email scandal. Mann was a central figure in the fracas, where a sampling of correspondence from climate scientists purloined from a computer server at the University of East Anglia in Britain supposedly showed climate scientists colluding to fabricate data and smear critics.
But a successive series of investigations and inquiries since the emails were released in 2009 have exonerated the scientists. The final conclusion from the NSF's Office of Inspector General is no different. "No direct evidence has been presented that indicates the subject fabricated the raw data he used for his research or falsified his results," the report concludes. Power Walk: Shoe Inserts Using Conductive Droplets Could Charge Personal Electronics on the Go. From Nature magazine. Forget to charge your phone? Your MP3 player? Soon, a quick stroll in a special pair of shoes could provide enough power to keep both going for hours.
There's a lot of 'oomph' in a step: up to 10 watts of power is lost as heat each time a foot hits the ground. Mobile devices such as phones and laptops use between 1 and 15 watts, so harnessing our 'foot power' would make a notable difference for consumers. So far, however, attempts to harvest this energy using vibrating plates or piezoelectric materials, which produce electricity when compressed or bent, have mustered only a few milliwatts.
Using as their basis a system published today in Nature Communications, mechanical engineers Tom Krupenkin and Ashley Taylor at the University of Wisconsin in Madison are now developing 'in-shoe technology' that could generate up to 10 watts of power per footstep. "If you run a motor in reverse you get an electrical generator," says Krupenkin, explaining that this is the same idea. Case study: why economics and addiction do not mix | The White Noise. Let me start by saying that I’m admittedly an economics fan. So much so that I nearly threw away my science and writing training and ran off into the sunset for an economics PhD. It’s the cleanness of it, the logic. The economics of everyday life seems shiny, interesting and alluring, and I delight in reads like Freakonomics. It’s comforting to know that we as a people make sense, regardless of how complicated we like to consider ourselves.
A recent headline on the Freakonomics blog proclaimed, “Cocaine Addicts Prefer Present Cash Over Future Coke” .. This struck me: “Until now, researchers believed that cocaine addicts valued the drug above any other commodity, no matter what the situation. So a portion of this study gave addicts an option of cocaine later versus money now.
When deprived of their addictive substance, addicts’ brains go into survival instinct mode with neurons ablaze and screaming “GET DRUGS NOW!” Economics, I do love you, but kindly get off addiction’s lawn. Cloud Formation May Be Linked to Cosmic Rays. From Nature magazine It sounds like a conspiracy theory: 'cosmic rays' from deep space might be creating clouds in Earth's atmosphere and changing the climate. Yet an experiment at CERN, Europe's high-energy physics laboratory near Geneva, Switzerland, is finding tentative evidence for just that. The findings, published today in Nature, are preliminary, but they are stoking a long-running argument over the role of radiation from distant stars in altering the climate.
On supporting science journalism If you're enjoying this article, consider supporting our award-winning journalism by subscribing. For a century, scientists have known that charged particles from space constantly bombard Earth. The number of cosmic rays that reach Earth depends on the Sun. Scientists agree on these basic facts, but there is far less agreement on whether cosmic rays can have a large role in cloud formation and climate change.
Early results seem to indicate that cosmic rays do cause a change. Others disagree. Diamond World Discovered by Astronomers: Scientific American Podcast. Say you need a diamond. You could go down to the jeweler, or you could put some carbon deep underground and let it sit for a couple billion years. Or you could hop in a starship and cruise 4,000 light years over to a dead star called pulsar J1719-1438. The pulsar is exotic on its own—it's a super-dense remnant of a star spinning at about 10,000 rpm. But far more curious is the world orbiting it, which might be called a planet if it weren't so strange. It's about as massive as Jupiter, but much more compact. It may be the remains of a carbon-rich white dwarf star. The object’s incredible density makes it subject to great internal pressure.
The next step for astronomers is to find out if the diamond planet has rings. —John Matson [The above text is a transcript of this podcast.] Can Hurricanes Be Controlled? A budding hurricane. Credit: David Fierstein Everyone likes to talk about the weather, and maybe someone could do something about it someday. From the dances and prayers of the past, we get to the weather-modification technology of the 24th century (at least, that’s what I recall from an episode of Star Trek: The Next Generation). Controlling cyclones is an effort entirely different from, say, making it rain. A storm as massive as Hurricane Irene would seem to defy any attempts by mere mortals to deflect it. Yet the idea isn’t as farfetched as it might seem, thanks to chaos theory. Ross N. Here’s how Hoffman described what he found in a simulation of the Hurricane Iniki, a 1992 storm that was the most powerful ever to hit the Hawaiian islands: The most significant modifications proved to be in the starting temperatures and winds.
Of course, just how to change those initial conditions is another matter. Thinking that humans can manipulate nature in this way seems hubristic. Researchers outline ways to advance scientific thinking in children. The dangers of the internet: Invisible sieve. Toxoplasma Infected Rats Love Their Enemies: Scientific American Podcast. Predator Cat Odors Activate Sexual Arousal Pathways in Brains of Toxoplasma gondii Infected Rats.
Your Brain in Love. Genetically Engineered Food for All. Science & Nature - Secrets of the Sexes.