Molecular Biology Protocols | Bioinformatics. VISTA tools. VISTA is a comprehensive suite of programs and databases for comparative analysis of genomic sequences. There are two ways of using VISTA - you can submit your own sequences and alignments for analysis (VISTA servers) or examine pre-computed whole-genome alignments of different species. mVISTAAlign and compare your sequences from multiple species rVISTALocate regulatory sequences in your data using comparative sequence analysis and transcription factor binding site search. gVISTACompare your sequences against whole-genome assemblies. wgVISTAAlign pair of sequences up to 10Mb long (finished or draft) including microbial whole-genome assemblies.
VISTA-PointAccess complete data and visual presentation of pairwise and multiple alignments of whole genome assemblies. VISTA BrowserExamine pre-computed pairwise and multiple alignments of whole genome assemblies. May 2013 Added the Human Feb. 2009 - Chimp Feb. 2011 pairwise alignment. ESEfinder 3.0 -- Input & output. ESEfinder accept sequences in the FASTA format. A sequence in FASTA format begins with a ">" and then a single line description, followed by lines sequence data. Multiple sequences are allowed and each one should have a descriptive line. An example of a FASTA file is given below: >seq1 aaatagacaattttaaaaaccaaacagaatgggactgtcttctgcaagcc tacctacaaacag >seq2 aaatcagttcgtcttcgttgcagcagatgaaatttcttgtaacacctctg cag The query sequences can be directly pasted into the text box, or can be uploaded from a text file To improve performance, the total size of query sequences in a submission is limited to 5000 nucelotides, no matter it is in a single sequence or in multiple sequences.
ESEfinder 3.0 has made a number changes in the output format. In the first page, the user can choose to generate output in either html format or plain text format. In html format, the result of each sequence is displayed separately, each has three sections sequence summary tabular output graphical output Example html output: SoftBerry. Michael Q. Zhang's Lab: Databases and Software Tools. BDGP: Berkeley Drosophila Genome Project (FruitFly)